control design tuning tool Search Results


94
Quanser Consulting dof helicopter
Dof Helicopter, supplied by Quanser Consulting, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dof helicopter/product/Quanser Consulting
Average 94 stars, based on 1 article reviews
dof helicopter - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

96
MathWorks Inc pid tuning algorithm
Pid Tuning Algorithm, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pid tuning algorithm/product/MathWorks Inc
Average 96 stars, based on 1 article reviews
pid tuning algorithm - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology vegf
Intestinal ischemia reperfusion (IIR)-induced changes of vascular endothelial growth factor <t>receptor</t> <t>(VEGFR)-2</t> in the lung tissue and immunoblotting of <t>VEGF</t> and its receptors. (a) VEGFR-2 immunostaining (four animals per group). Slides (magnification 1,000×) shown are representatives of indicated groups. Positively stained cells are in brown (examples are indicated with arrowheads). In the IIR group, some of the positive cells appear to be interstitial monocytes with strong staining in the cytoplasm. (b) Quantification of VEGFR-2-positive cells per field. Ten fields were counted from each animal and four animals from each group. (c) Western blotting for VEGF and its receptors. Results from two animals per group are used as examples. The optical density of blot bands were quantified with desitometry and normalized to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as controls. No significant difference was found among these three groups.
Vegf, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/vegf/product/Santa Cruz Biotechnology
Average 96 stars, based on 1 article reviews
vegf - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

96
MathWorks Inc controller
SISO LPS/iNOS ARX model, <t>controller</t> design, and experimental MPC testing. (A) Identified ARX model of macrophage iNOS response to LPS has a characteristic step response that follows the experimentally quantified trajectory. Control system design identifies input strategy (dashed line) for a step reference that elicits a gradual increase in plant response (blue stems) using a (B) PI or (C) LQG controller. Model simulations given controller defined inputs but within experimental input constraints predict sustained outputs for (D) PI and (E) LQG controllers. (F) A heuristically defined three-step increase input strategy predicts an output that reaches a maximum at 72 h. Experimental implementation using cultured RAW 264.7 macrophages and (G) PI controller-, (H) LQG controller-, or (I) a heuristic combination of designed LPS input schema (dashed line) modulates temporal iNOS expression (red curves, mean ± SEM, N = 16; interpolated curve ± RMS CV error) but does not reach the unit reference nor sustain 72 h activity. Macrophage refractory response to repeated LPS input is captured (blue stems) by multiplying the (J) PI predicted, (K) LQG predicted, or (L) heuristically defined input sequences against a time-dependent exponential decay term (dashed lines).
Controller, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/controller/product/MathWorks Inc
Average 96 stars, based on 1 article reviews
controller - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

93
Thermo Fisher gene exp egfr mm00433023 m1
<t>Egfr</t> activity contributes to RT2 tumor growth and angiogenic switching. ( A ) Relative expression quantified by real-time quantitative PCR of Erbb family members in cDNAs derived from total RNA extracts of successive stages of pancreatic neuroendocrine tumorigenesis from RIP1-Tag2 (RT2) transgenic mice (NI = normal islets; HI = hyperplastic islets; AI = angiogenic islets; IT = islet tumors). Levels of mRNAs are expressed as a percentage of the mGus control mRNA. ( B ) Western blot analysis of protein extracts from successive stages of RT2-derived lesions. ( C ) Western blot analysis of protein extracts from RT2-derived tumors 4 h after treatment with a vehicle solution or erlotinib (80 mg/kg). ( D-F ) Comparison of the average tumor burden of RT2 mice treated daily with a control solution (vehicle) or with ( D ) gefitinib (80 mg/kg), ( E ) CI-1033 (80 mg/kg), both from 11.5 to 14.5 weeks of age, or with ( F ) erlotinib (80 mg/kg), from 12 to 16 weeks of age with an additional vehicle-treated time point at 14 weeks. ( G ) Comparison of the average number of hemorrhagic angiogenic islets per pancreas of RT2 mice treated daily with a vehicle solution or with erlotinib (80 mg/kg) or CI-1033 (80 mg/kg) from 6 to 9 weeks of age. ( N = number of animals per treatment group). * P < 0.01.
Gene Exp Egfr Mm00433023 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp egfr mm00433023 m1/product/Thermo Fisher
Average 93 stars, based on 1 article reviews
gene exp egfr mm00433023 m1 - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology nlrp2 sirna
(A) Quantitative reverse-transcription polymerase chain reaction (qRT–PCR) with total RNA extracted from 4-week-old mouse ovary (Ov), uterus (Ut), testis (Te), kidney (Ki), lung (Lu), heart (He), liver (Li), brain (Br), stomach (St), intestines (In), muscle (Mu), spleen (Sp) were performed. Results were normalized to the abundance in the ovary and expressed as the mean ± SEM. (B) In situ hybridization of fixed, paraffin wax-embedded 6 µm ovary sections probed with DIG-labeled <t>Nlrp2</t> oligonucleotide probes. The original magnification was ×100. (C) The relative abundance of Nlrp2 transcripts in mouse oocytes and preimplantation embryos. (D) The relative abundance of Nlrp2 transcripts in different mouse cells.
Nlrp2 Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nlrp2 sirna/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
nlrp2 sirna - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

94
Thermo Fisher gene exp mzb1 hs00414907 m1
<t>MZB1</t> is a highly expressed protein in lymph nodes from SLE patients. a Volcano plot showing distribution of all proteins in lymph nodes from SLE patients ( n = 3) and controls ( n = 3) analyzed by LC-MS. Horizontal line denotes fold change. Vertical line represents p value (ANOVA). Differences > 1.5-fold change and p ≤ 0.05 considered statistically significant. Fold-change values indicate higher (+) and lower (–) expression in SLE patients compared with controls. Significant proteins labeled with their gene name. b Representative immunoblotting for MZB1 in lymph node tissue from SLE patients and controls. Right: Quantification of the immunoblot ( n = 3 each). Mean band intensity ratio measured as the intensity of the MZB1 band divided by intensity of the corresponding beta-actin band. Error bars indicate SEM. c Upper: histological section of an axillary lymph node from SLE patients showing reactive follicular hyperplasia. HE, scale bar = 100 μm. Middle: MZB1 immunostaining of the same sample of the upper image, showing numerous positive cells in the interfollicular area and within the germinal center. Scale bar = 50 μm. Lower: MZB1 immunostaining of the control. Scale bar = 50 μm. d MZB1 + cells in lymph nodes from SLE patients were significantly more frequently observed in the germinal center and interfollicular areas compared with those from controls. * p <0.05; ** p <0.01 HPF high-power field, SLE systemic lupus erythematosus
Gene Exp Mzb1 Hs00414907 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp mzb1 hs00414907 m1/product/Thermo Fisher
Average 94 stars, based on 1 article reviews
gene exp mzb1 hs00414907 m1 - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

Image Search Results


Intestinal ischemia reperfusion (IIR)-induced changes of vascular endothelial growth factor receptor (VEGFR)-2 in the lung tissue and immunoblotting of VEGF and its receptors. (a) VEGFR-2 immunostaining (four animals per group). Slides (magnification 1,000×) shown are representatives of indicated groups. Positively stained cells are in brown (examples are indicated with arrowheads). In the IIR group, some of the positive cells appear to be interstitial monocytes with strong staining in the cytoplasm. (b) Quantification of VEGFR-2-positive cells per field. Ten fields were counted from each animal and four animals from each group. (c) Western blotting for VEGF and its receptors. Results from two animals per group are used as examples. The optical density of blot bands were quantified with desitometry and normalized to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as controls. No significant difference was found among these three groups.

Journal: Critical Care

Article Title: The early responses of VEGF and its receptors during acute lung injury: implication of VEGF in alveolar epithelial cell survival

doi: 10.1186/cc5042

Figure Lengend Snippet: Intestinal ischemia reperfusion (IIR)-induced changes of vascular endothelial growth factor receptor (VEGFR)-2 in the lung tissue and immunoblotting of VEGF and its receptors. (a) VEGFR-2 immunostaining (four animals per group). Slides (magnification 1,000×) shown are representatives of indicated groups. Positively stained cells are in brown (examples are indicated with arrowheads). In the IIR group, some of the positive cells appear to be interstitial monocytes with strong staining in the cytoplasm. (b) Quantification of VEGFR-2-positive cells per field. Ten fields were counted from each animal and four animals from each group. (c) Western blotting for VEGF and its receptors. Results from two animals per group are used as examples. The optical density of blot bands were quantified with desitometry and normalized to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as controls. No significant difference was found among these three groups.

Article Snippet: The slides were incubated with designated primary antibodies, with a dilution of 1:200 for VEGF (sc-507), 1:20 for VEGFR-1 (sc-316) and VEGFR-2 (sc-505) from Santa Cruz Biotechnology (Santa Cruz, CA, USA), for 32 minutes at 42°C, and then with a secondary antibody (1:600) for 20 minutes.

Techniques: Western Blot, Immunostaining, Staining

Intestinal ischemia reperfusion (IIR)-induced alveolar epithelial cell death is negatively correlated with vascular endothelial growth factor (VEGF) and vascular endothelial growth factor receptor (VEGFR)-1 expression. (a) Double fluorescents staining TUNEL (red)-cytokeratin (green). An increased number of epithelial cells (in green) undergoing cell death (in red) was detected in the IIR group. Slides shown are representatives of four animals from each group. (b) Epithelial cell death index was quantified by TUNEL-cytokeratin double positive cells over cytokeratin positive cells of each field (ten fields were quantified from each animal); * p < 0.05 compared with the control group; # p < 0.05 compared with the sham group. (c) Relationship between TUNEL-positive-epithelial cells and VEGF-positive cells. (d) Relationship between TUNEL-positive-epithelial cells and VEGFR-1-positive cells.

Journal: Critical Care

Article Title: The early responses of VEGF and its receptors during acute lung injury: implication of VEGF in alveolar epithelial cell survival

doi: 10.1186/cc5042

Figure Lengend Snippet: Intestinal ischemia reperfusion (IIR)-induced alveolar epithelial cell death is negatively correlated with vascular endothelial growth factor (VEGF) and vascular endothelial growth factor receptor (VEGFR)-1 expression. (a) Double fluorescents staining TUNEL (red)-cytokeratin (green). An increased number of epithelial cells (in green) undergoing cell death (in red) was detected in the IIR group. Slides shown are representatives of four animals from each group. (b) Epithelial cell death index was quantified by TUNEL-cytokeratin double positive cells over cytokeratin positive cells of each field (ten fields were quantified from each animal); * p < 0.05 compared with the control group; # p < 0.05 compared with the sham group. (c) Relationship between TUNEL-positive-epithelial cells and VEGF-positive cells. (d) Relationship between TUNEL-positive-epithelial cells and VEGFR-1-positive cells.

Article Snippet: The slides were incubated with designated primary antibodies, with a dilution of 1:200 for VEGF (sc-507), 1:20 for VEGFR-1 (sc-316) and VEGFR-2 (sc-505) from Santa Cruz Biotechnology (Santa Cruz, CA, USA), for 32 minutes at 42°C, and then with a secondary antibody (1:600) for 20 minutes.

Techniques: Expressing, Staining, TUNEL Assay, Control

Lung epithelial cell death induced by vascular endothelial growth factor (VEGF) or vascular endothelial growth factor receptor (VEGFR)-1 knock-down. Human A549 cells were cultured in 24-well plates and transfected with 50 nM of small interference RNA (siRNA) specifically against either VEGF or VEGFR-1, or with a non-specific duplex RNA (NS) as control for 24 h. (a) VEGF or VEGFR-1 siRNA induced changes in cell number and/or cell morphology in A549 cells. Pictures shown are representatives for each treatment (magnification 400×). (b) XTT assay for cell viability. The data shown are mean ± standard deviation from three separated experiments. ** p < 0.01 versus the non-specific control. (c) VEGF and VEGFR-1 immunofluorescent staining at 24 h after treatment with different RNA duplexes. Decreased staining was noted in siRNA treated cells. (d) Western blots confirmed that siRNA specifically reduced VEGF or VEGFR-1 protein expression.

Journal: Critical Care

Article Title: The early responses of VEGF and its receptors during acute lung injury: implication of VEGF in alveolar epithelial cell survival

doi: 10.1186/cc5042

Figure Lengend Snippet: Lung epithelial cell death induced by vascular endothelial growth factor (VEGF) or vascular endothelial growth factor receptor (VEGFR)-1 knock-down. Human A549 cells were cultured in 24-well plates and transfected with 50 nM of small interference RNA (siRNA) specifically against either VEGF or VEGFR-1, or with a non-specific duplex RNA (NS) as control for 24 h. (a) VEGF or VEGFR-1 siRNA induced changes in cell number and/or cell morphology in A549 cells. Pictures shown are representatives for each treatment (magnification 400×). (b) XTT assay for cell viability. The data shown are mean ± standard deviation from three separated experiments. ** p < 0.01 versus the non-specific control. (c) VEGF and VEGFR-1 immunofluorescent staining at 24 h after treatment with different RNA duplexes. Decreased staining was noted in siRNA treated cells. (d) Western blots confirmed that siRNA specifically reduced VEGF or VEGFR-1 protein expression.

Article Snippet: The slides were incubated with designated primary antibodies, with a dilution of 1:200 for VEGF (sc-507), 1:20 for VEGFR-1 (sc-316) and VEGFR-2 (sc-505) from Santa Cruz Biotechnology (Santa Cruz, CA, USA), for 32 minutes at 42°C, and then with a secondary antibody (1:600) for 20 minutes.

Techniques: Knockdown, Cell Culture, Transfection, Control, XTT Assay, Standard Deviation, Staining, Western Blot, Expressing

SISO LPS/iNOS ARX model, controller design, and experimental MPC testing. (A) Identified ARX model of macrophage iNOS response to LPS has a characteristic step response that follows the experimentally quantified trajectory. Control system design identifies input strategy (dashed line) for a step reference that elicits a gradual increase in plant response (blue stems) using a (B) PI or (C) LQG controller. Model simulations given controller defined inputs but within experimental input constraints predict sustained outputs for (D) PI and (E) LQG controllers. (F) A heuristically defined three-step increase input strategy predicts an output that reaches a maximum at 72 h. Experimental implementation using cultured RAW 264.7 macrophages and (G) PI controller-, (H) LQG controller-, or (I) a heuristic combination of designed LPS input schema (dashed line) modulates temporal iNOS expression (red curves, mean ± SEM, N = 16; interpolated curve ± RMS CV error) but does not reach the unit reference nor sustain 72 h activity. Macrophage refractory response to repeated LPS input is captured (blue stems) by multiplying the (J) PI predicted, (K) LQG predicted, or (L) heuristically defined input sequences against a time-dependent exponential decay term (dashed lines).

Journal: Frontiers in Bioengineering and Biotechnology

Article Title: Experimental Control of Macrophage Pro-Inflammatory Dynamics Using Predictive Models

doi: 10.3389/fbioe.2020.00666

Figure Lengend Snippet: SISO LPS/iNOS ARX model, controller design, and experimental MPC testing. (A) Identified ARX model of macrophage iNOS response to LPS has a characteristic step response that follows the experimentally quantified trajectory. Control system design identifies input strategy (dashed line) for a step reference that elicits a gradual increase in plant response (blue stems) using a (B) PI or (C) LQG controller. Model simulations given controller defined inputs but within experimental input constraints predict sustained outputs for (D) PI and (E) LQG controllers. (F) A heuristically defined three-step increase input strategy predicts an output that reaches a maximum at 72 h. Experimental implementation using cultured RAW 264.7 macrophages and (G) PI controller-, (H) LQG controller-, or (I) a heuristic combination of designed LPS input schema (dashed line) modulates temporal iNOS expression (red curves, mean ± SEM, N = 16; interpolated curve ± RMS CV error) but does not reach the unit reference nor sustain 72 h activity. Macrophage refractory response to repeated LPS input is captured (blue stems) by multiplying the (J) PI predicted, (K) LQG predicted, or (L) heuristically defined input sequences against a time-dependent exponential decay term (dashed lines).

Article Snippet: Using the identified ARX system model, we sought to tune a controller (Control System Design Toolbox, MATLAB), placed upstream of the plant , that would predict a temporally defined LPS input strategy to overcome the persistent decay in iNOS expression.

Techniques: Control, Cell Culture, Expressing, Activity Assay

Egfr activity contributes to RT2 tumor growth and angiogenic switching. ( A ) Relative expression quantified by real-time quantitative PCR of Erbb family members in cDNAs derived from total RNA extracts of successive stages of pancreatic neuroendocrine tumorigenesis from RIP1-Tag2 (RT2) transgenic mice (NI = normal islets; HI = hyperplastic islets; AI = angiogenic islets; IT = islet tumors). Levels of mRNAs are expressed as a percentage of the mGus control mRNA. ( B ) Western blot analysis of protein extracts from successive stages of RT2-derived lesions. ( C ) Western blot analysis of protein extracts from RT2-derived tumors 4 h after treatment with a vehicle solution or erlotinib (80 mg/kg). ( D-F ) Comparison of the average tumor burden of RT2 mice treated daily with a control solution (vehicle) or with ( D ) gefitinib (80 mg/kg), ( E ) CI-1033 (80 mg/kg), both from 11.5 to 14.5 weeks of age, or with ( F ) erlotinib (80 mg/kg), from 12 to 16 weeks of age with an additional vehicle-treated time point at 14 weeks. ( G ) Comparison of the average number of hemorrhagic angiogenic islets per pancreas of RT2 mice treated daily with a vehicle solution or with erlotinib (80 mg/kg) or CI-1033 (80 mg/kg) from 6 to 9 weeks of age. ( N = number of animals per treatment group). * P < 0.01.

Journal: Genes & Cancer

Article Title: Differential Contribution to Neuroendocrine Tumorigenesis of Parallel Egfr Signaling in Cancer Cells and Pericytes

doi: 10.1177/1947601909358722

Figure Lengend Snippet: Egfr activity contributes to RT2 tumor growth and angiogenic switching. ( A ) Relative expression quantified by real-time quantitative PCR of Erbb family members in cDNAs derived from total RNA extracts of successive stages of pancreatic neuroendocrine tumorigenesis from RIP1-Tag2 (RT2) transgenic mice (NI = normal islets; HI = hyperplastic islets; AI = angiogenic islets; IT = islet tumors). Levels of mRNAs are expressed as a percentage of the mGus control mRNA. ( B ) Western blot analysis of protein extracts from successive stages of RT2-derived lesions. ( C ) Western blot analysis of protein extracts from RT2-derived tumors 4 h after treatment with a vehicle solution or erlotinib (80 mg/kg). ( D-F ) Comparison of the average tumor burden of RT2 mice treated daily with a control solution (vehicle) or with ( D ) gefitinib (80 mg/kg), ( E ) CI-1033 (80 mg/kg), both from 11.5 to 14.5 weeks of age, or with ( F ) erlotinib (80 mg/kg), from 12 to 16 weeks of age with an additional vehicle-treated time point at 14 weeks. ( G ) Comparison of the average number of hemorrhagic angiogenic islets per pancreas of RT2 mice treated daily with a vehicle solution or with erlotinib (80 mg/kg) or CI-1033 (80 mg/kg) from 6 to 9 weeks of age. ( N = number of animals per treatment group). * P < 0.01.

Article Snippet: Quantitative real-time PCR was performed using the following TaqMan® assays (Applied Biosystems, Foster City, CA) or specifically designed assays: Mm00433023_m1 ( Egfr/Erbb1 ), Mm00658541_m1 ( Erbb2 ), For: cgggacccaccaaggtatc/Rev:ttggtgctcagagcagatgg/Probe:fam-tcatcaagagagcgagtgggcctgg-bhq1 ( Erbb3 ), For: gctgctcaggaccaaaggac/Rev:agtaacgcaggctccactgtc/Probe:fam-ctgactgctttgcctgcatgaacttca-bhq1 ( Erbb4 ), Mm00438696_m1 ( Egf ), Mm00437583_m1 ( Areg ), Mm00504344_m1 ( Epg ), Mm00446231_m1 ( Tgfa ), Mm00514794_m1 ( Epr ), Mm00432137_m1 ( Btc ), Mm00439307_m1 ( Hb-egf/Dtr ), Mm00626552_m1 ( Nrg-1 ), For:aatggaggcgtgtgctactaca/Rev:ccgaagaatccgtttggaca/Probe:fam-cgaaggcatcaaccaactctcctgca-bhq1 ( Nrg-2a ), For: tggaggcgtgtgctactacatc/Rev:cccggtgtatcccacagg/Probe: fam-aaggcatcaaccaactctcctgcaagtg-bhq1 ( Nrg-2b ), Mm004- 35367_m1 ( Nrg-3 ), Mm00446254_m1 ( Nrg-4 ), Hs01076092_m1 (Human EGFR), Hs00961131_m1 (Human HBEGF), Hs00177401_m1 (Human TGF-α), For:ctcatctggaatttcgccga/Rev:ggcgagtgaagatccccttc/Probe:fam-cgaaccagtcaccgctgagagtaatcg-bhq1 ( mGus ), Mm00435546_m1 ( PDGFR -β), Mm00476702_m1 ( Pecam1/CD31 ), and Mm00448463_m1 ( Ptprt/CD45 ).

Techniques: Activity Assay, Expressing, Real-time Polymerase Chain Reaction, Derivative Assay, Transgenic Assay, Control, Western Blot, Comparison

Phenotype of epidermal growth factor receptor (EGFR) inhibitor-treated pancreatic neuroendocrine tumorigenesis (PNET) tumors from RT2 mice. ( A ) Average percentage of dividing tumor cells (BrdU-positive) in vehicle- or erlotinib-treated mice following 1 week of treatment. ( B-C ) Representative micrographs of tumors from ( B ) vehicle- or ( C ) erlotinib-treated RT2 mice stained with an anti-BrdU antibody (200x). ( D ) Average percentage of apoptotic tumor cells (TdT-mediated dUTP-biotin nick end-labeling [TUNEL] positive) in tumors from vehicle- or erlotinib-treated mice following 1 week of treatment. ( E-F ) Representative micrographs of ( E ) vehicle- or ( F ) erlotinib-treated tumors stained with an anti-digoxigenin antibody following Tunel procedure (200x). ( G ) Average number of blood vessels per field (FITC-positive continuous segments) in vehicle- or erlotinib-treated mice following 1 week of treatment. ( H-I ) Representative micrographs of ( H ) vehicle- or ( I ) erlotinib-treated tumors that were collected following systemic perfusion with FITC-lectin to visualize the functional tumor vasculature (green); counterstaining with DAPI reveals the cellularity (blue) (200x). The panels are representative of 2 fields of tissue sections obtained from tumors in at least 4 treated RT2 mice. ( N = number of independent tumors analyzed per treatment group). * P < 0.001. ** P < 0.02.

Journal: Genes & Cancer

Article Title: Differential Contribution to Neuroendocrine Tumorigenesis of Parallel Egfr Signaling in Cancer Cells and Pericytes

doi: 10.1177/1947601909358722

Figure Lengend Snippet: Phenotype of epidermal growth factor receptor (EGFR) inhibitor-treated pancreatic neuroendocrine tumorigenesis (PNET) tumors from RT2 mice. ( A ) Average percentage of dividing tumor cells (BrdU-positive) in vehicle- or erlotinib-treated mice following 1 week of treatment. ( B-C ) Representative micrographs of tumors from ( B ) vehicle- or ( C ) erlotinib-treated RT2 mice stained with an anti-BrdU antibody (200x). ( D ) Average percentage of apoptotic tumor cells (TdT-mediated dUTP-biotin nick end-labeling [TUNEL] positive) in tumors from vehicle- or erlotinib-treated mice following 1 week of treatment. ( E-F ) Representative micrographs of ( E ) vehicle- or ( F ) erlotinib-treated tumors stained with an anti-digoxigenin antibody following Tunel procedure (200x). ( G ) Average number of blood vessels per field (FITC-positive continuous segments) in vehicle- or erlotinib-treated mice following 1 week of treatment. ( H-I ) Representative micrographs of ( H ) vehicle- or ( I ) erlotinib-treated tumors that were collected following systemic perfusion with FITC-lectin to visualize the functional tumor vasculature (green); counterstaining with DAPI reveals the cellularity (blue) (200x). The panels are representative of 2 fields of tissue sections obtained from tumors in at least 4 treated RT2 mice. ( N = number of independent tumors analyzed per treatment group). * P < 0.001. ** P < 0.02.

Article Snippet: Quantitative real-time PCR was performed using the following TaqMan® assays (Applied Biosystems, Foster City, CA) or specifically designed assays: Mm00433023_m1 ( Egfr/Erbb1 ), Mm00658541_m1 ( Erbb2 ), For: cgggacccaccaaggtatc/Rev:ttggtgctcagagcagatgg/Probe:fam-tcatcaagagagcgagtgggcctgg-bhq1 ( Erbb3 ), For: gctgctcaggaccaaaggac/Rev:agtaacgcaggctccactgtc/Probe:fam-ctgactgctttgcctgcatgaacttca-bhq1 ( Erbb4 ), Mm00438696_m1 ( Egf ), Mm00437583_m1 ( Areg ), Mm00504344_m1 ( Epg ), Mm00446231_m1 ( Tgfa ), Mm00514794_m1 ( Epr ), Mm00432137_m1 ( Btc ), Mm00439307_m1 ( Hb-egf/Dtr ), Mm00626552_m1 ( Nrg-1 ), For:aatggaggcgtgtgctactaca/Rev:ccgaagaatccgtttggaca/Probe:fam-cgaaggcatcaaccaactctcctgca-bhq1 ( Nrg-2a ), For: tggaggcgtgtgctactacatc/Rev:cccggtgtatcccacagg/Probe: fam-aaggcatcaaccaactctcctgcaagtg-bhq1 ( Nrg-2b ), Mm004- 35367_m1 ( Nrg-3 ), Mm00446254_m1 ( Nrg-4 ), Hs01076092_m1 (Human EGFR), Hs00961131_m1 (Human HBEGF), Hs00177401_m1 (Human TGF-α), For:ctcatctggaatttcgccga/Rev:ggcgagtgaagatccccttc/Probe:fam-cgaaccagtcaccgctgagagtaatcg-bhq1 ( mGus ), Mm00435546_m1 ( PDGFR -β), Mm00476702_m1 ( Pecam1/CD31 ), and Mm00448463_m1 ( Ptprt/CD45 ).

Techniques: Staining, End Labeling, TUNEL Assay, Functional Assay

Distinct pools of Egfr activity in cancer cells and perivascular cells. ( A ) Expression of cell-type defining genes m-Insulin1 , Pecam1 , Pdgfr -β, Ptprt , and of Egfr , Hb-egf , and Tgf -α in sorted cells from RT2-derived PNET tumors (NS = nonsorted cells; EC = endothelial cells; PC = pericytes; IC = immune cells; TC = unlabeled tumor cells) relative to the expression detected in nonsorted cells (NS = 1). Gene expression in each cellular fraction was normalized to levels of Cyclophilin . ( B ) Comparison of the relative in vitro growth of 2 RT2 tumor-derived cancer cell lines (BTC3 and BTC4) following 3 days of treatment with DMSO or gefitinib 5 μM. ( C ) Anti-NG2 staining (red) reveals pericytes (200x). ( D ) Co-localization of NG2 (red) with phospho-EGFR Tyr1068 (pEgfr, green) (200x). ( E ) High magnification confocal localization reveals expression of phospho-Egfr (green) in pericytes expressing NG2 (red) (1600x). ( F ) High-magnification confocal localization of phospho-Egfr (green) and an endothelial specific marker (Meca-32, red) does not indicate Egfr activity in tumor endothelial cells (2,000x). ( C-H ) Micrographs are representative of multiple fields of more than 10 tumors from at least 3 independent RT2 mice.

Journal: Genes & Cancer

Article Title: Differential Contribution to Neuroendocrine Tumorigenesis of Parallel Egfr Signaling in Cancer Cells and Pericytes

doi: 10.1177/1947601909358722

Figure Lengend Snippet: Distinct pools of Egfr activity in cancer cells and perivascular cells. ( A ) Expression of cell-type defining genes m-Insulin1 , Pecam1 , Pdgfr -β, Ptprt , and of Egfr , Hb-egf , and Tgf -α in sorted cells from RT2-derived PNET tumors (NS = nonsorted cells; EC = endothelial cells; PC = pericytes; IC = immune cells; TC = unlabeled tumor cells) relative to the expression detected in nonsorted cells (NS = 1). Gene expression in each cellular fraction was normalized to levels of Cyclophilin . ( B ) Comparison of the relative in vitro growth of 2 RT2 tumor-derived cancer cell lines (BTC3 and BTC4) following 3 days of treatment with DMSO or gefitinib 5 μM. ( C ) Anti-NG2 staining (red) reveals pericytes (200x). ( D ) Co-localization of NG2 (red) with phospho-EGFR Tyr1068 (pEgfr, green) (200x). ( E ) High magnification confocal localization reveals expression of phospho-Egfr (green) in pericytes expressing NG2 (red) (1600x). ( F ) High-magnification confocal localization of phospho-Egfr (green) and an endothelial specific marker (Meca-32, red) does not indicate Egfr activity in tumor endothelial cells (2,000x). ( C-H ) Micrographs are representative of multiple fields of more than 10 tumors from at least 3 independent RT2 mice.

Article Snippet: Quantitative real-time PCR was performed using the following TaqMan® assays (Applied Biosystems, Foster City, CA) or specifically designed assays: Mm00433023_m1 ( Egfr/Erbb1 ), Mm00658541_m1 ( Erbb2 ), For: cgggacccaccaaggtatc/Rev:ttggtgctcagagcagatgg/Probe:fam-tcatcaagagagcgagtgggcctgg-bhq1 ( Erbb3 ), For: gctgctcaggaccaaaggac/Rev:agtaacgcaggctccactgtc/Probe:fam-ctgactgctttgcctgcatgaacttca-bhq1 ( Erbb4 ), Mm00438696_m1 ( Egf ), Mm00437583_m1 ( Areg ), Mm00504344_m1 ( Epg ), Mm00446231_m1 ( Tgfa ), Mm00514794_m1 ( Epr ), Mm00432137_m1 ( Btc ), Mm00439307_m1 ( Hb-egf/Dtr ), Mm00626552_m1 ( Nrg-1 ), For:aatggaggcgtgtgctactaca/Rev:ccgaagaatccgtttggaca/Probe:fam-cgaaggcatcaaccaactctcctgca-bhq1 ( Nrg-2a ), For: tggaggcgtgtgctactacatc/Rev:cccggtgtatcccacagg/Probe: fam-aaggcatcaaccaactctcctgcaagtg-bhq1 ( Nrg-2b ), Mm004- 35367_m1 ( Nrg-3 ), Mm00446254_m1 ( Nrg-4 ), Hs01076092_m1 (Human EGFR), Hs00961131_m1 (Human HBEGF), Hs00177401_m1 (Human TGF-α), For:ctcatctggaatttcgccga/Rev:ggcgagtgaagatccccttc/Probe:fam-cgaaccagtcaccgctgagagtaatcg-bhq1 ( mGus ), Mm00435546_m1 ( PDGFR -β), Mm00476702_m1 ( Pecam1/CD31 ), and Mm00448463_m1 ( Ptprt/CD45 ).

Techniques: Activity Assay, Expressing, Derivative Assay, Gene Expression, Comparison, In Vitro, Staining, Marker

Contributions of Hb-egf and Egfr to pericyte coverage of the tumor neovasculature. ( A-D, G ) Pericyte coverage of the endothelium as a percentage of total vessel area in different stages and genetic contexts. ( A ) Comparison of vehicle- and erlotinib-treated tumors from 14-week-old RT2 mice. ( B ) Comparison of angiogenic islets from 9-week-old wild-type versus Hb-egf mutant RT2 mice. ( C ) Comparison of wild-type versus Hb-egf mutant tumors from 14-week-old RT2 mice. ( D ) Comparison of small wild-type and Hb-egf mutant tumors (ø < 3 mm) from 14-week-old RT2 mice. ( G ) Comparison of wild-type and mutant exocrine pancreas. ( E-F ) Representative staining of angiogenic microvessels (with Meca-32; red) and pericytes (with Desmin; green) (400x) in small ( E ) wild-type and ( F ) Hb-egf mutant tumors. ( N = number of fields of tumors or angiogenic islet analyzed per genotype or treatment group; 1-2 fields per lesion analyzed.) ( H-I ) Representative staining of a pericyte marker (NG2; red) and activated phospho-Egfr (green) in tumors from ( H ) wild-type or ( I ) Hb-egf mutant RT2 mice. Micrographs are representative of several fields of more than 10 RT2 tumors from at least 3 independent mice of each genotype. * P < 0.05. ** P < 0.01. *** P < 0.001.

Journal: Genes & Cancer

Article Title: Differential Contribution to Neuroendocrine Tumorigenesis of Parallel Egfr Signaling in Cancer Cells and Pericytes

doi: 10.1177/1947601909358722

Figure Lengend Snippet: Contributions of Hb-egf and Egfr to pericyte coverage of the tumor neovasculature. ( A-D, G ) Pericyte coverage of the endothelium as a percentage of total vessel area in different stages and genetic contexts. ( A ) Comparison of vehicle- and erlotinib-treated tumors from 14-week-old RT2 mice. ( B ) Comparison of angiogenic islets from 9-week-old wild-type versus Hb-egf mutant RT2 mice. ( C ) Comparison of wild-type versus Hb-egf mutant tumors from 14-week-old RT2 mice. ( D ) Comparison of small wild-type and Hb-egf mutant tumors (ø < 3 mm) from 14-week-old RT2 mice. ( G ) Comparison of wild-type and mutant exocrine pancreas. ( E-F ) Representative staining of angiogenic microvessels (with Meca-32; red) and pericytes (with Desmin; green) (400x) in small ( E ) wild-type and ( F ) Hb-egf mutant tumors. ( N = number of fields of tumors or angiogenic islet analyzed per genotype or treatment group; 1-2 fields per lesion analyzed.) ( H-I ) Representative staining of a pericyte marker (NG2; red) and activated phospho-Egfr (green) in tumors from ( H ) wild-type or ( I ) Hb-egf mutant RT2 mice. Micrographs are representative of several fields of more than 10 RT2 tumors from at least 3 independent mice of each genotype. * P < 0.05. ** P < 0.01. *** P < 0.001.

Article Snippet: Quantitative real-time PCR was performed using the following TaqMan® assays (Applied Biosystems, Foster City, CA) or specifically designed assays: Mm00433023_m1 ( Egfr/Erbb1 ), Mm00658541_m1 ( Erbb2 ), For: cgggacccaccaaggtatc/Rev:ttggtgctcagagcagatgg/Probe:fam-tcatcaagagagcgagtgggcctgg-bhq1 ( Erbb3 ), For: gctgctcaggaccaaaggac/Rev:agtaacgcaggctccactgtc/Probe:fam-ctgactgctttgcctgcatgaacttca-bhq1 ( Erbb4 ), Mm00438696_m1 ( Egf ), Mm00437583_m1 ( Areg ), Mm00504344_m1 ( Epg ), Mm00446231_m1 ( Tgfa ), Mm00514794_m1 ( Epr ), Mm00432137_m1 ( Btc ), Mm00439307_m1 ( Hb-egf/Dtr ), Mm00626552_m1 ( Nrg-1 ), For:aatggaggcgtgtgctactaca/Rev:ccgaagaatccgtttggaca/Probe:fam-cgaaggcatcaaccaactctcctgca-bhq1 ( Nrg-2a ), For: tggaggcgtgtgctactacatc/Rev:cccggtgtatcccacagg/Probe: fam-aaggcatcaaccaactctcctgcaagtg-bhq1 ( Nrg-2b ), Mm004- 35367_m1 ( Nrg-3 ), Mm00446254_m1 ( Nrg-4 ), Hs01076092_m1 (Human EGFR), Hs00961131_m1 (Human HBEGF), Hs00177401_m1 (Human TGF-α), For:ctcatctggaatttcgccga/Rev:ggcgagtgaagatccccttc/Probe:fam-cgaaccagtcaccgctgagagtaatcg-bhq1 ( mGus ), Mm00435546_m1 ( PDGFR -β), Mm00476702_m1 ( Pecam1/CD31 ), and Mm00448463_m1 ( Ptprt/CD45 ).

Techniques: Comparison, Mutagenesis, Staining, Marker

Mesenchymal-derived Hb-egf activates Egfr inside tumor pericytes. ( A-B ) Co-staining of Hb-egf staining (red) and Meca-32 (endothelial cell marker; green) by confocal microscopy (2,520x) reveals both cancer cell expression (red) and endothelial cell co-localization (yellow) of Hb-egf. ( C ) Schematic description of the orthotopic transplant experiment aimed at assessing the contribution of mesenchymal-derived Hb-egf to the angiogenic phenotype of pancreatic neuroendocrine tumorigenesis (PNET) tumors. ( D ) Comparison of pericyte coverage of the tumor neovasculature in wild-type (wt) versus Hb-egf mutant (Hb−/−) hosts. ** P < 0.0005. (Number of tumors analyzed for each host genotype: N wt = 11, N Hb = 12.) ( E-F ) Representative staining of tumors for nuclei (DAPI; blue), NG2 (pericyte marker; red), and pEgfr (green) illustrating that the readily detectable pEgfr signal localized to pericytes in wild-type hosts (white arrows) ( E ) disappears in Hb-egf mutant hosts ( F ). pEgfr can be detected in cancer cells but at many-fold lower levels than in perivascular cells (see Supplementary Fig. S4). Micrographs are representative of 2 fields of 12 and 11 tumors obtained from wt or Hb-egf mutant hosts, respectively.

Journal: Genes & Cancer

Article Title: Differential Contribution to Neuroendocrine Tumorigenesis of Parallel Egfr Signaling in Cancer Cells and Pericytes

doi: 10.1177/1947601909358722

Figure Lengend Snippet: Mesenchymal-derived Hb-egf activates Egfr inside tumor pericytes. ( A-B ) Co-staining of Hb-egf staining (red) and Meca-32 (endothelial cell marker; green) by confocal microscopy (2,520x) reveals both cancer cell expression (red) and endothelial cell co-localization (yellow) of Hb-egf. ( C ) Schematic description of the orthotopic transplant experiment aimed at assessing the contribution of mesenchymal-derived Hb-egf to the angiogenic phenotype of pancreatic neuroendocrine tumorigenesis (PNET) tumors. ( D ) Comparison of pericyte coverage of the tumor neovasculature in wild-type (wt) versus Hb-egf mutant (Hb−/−) hosts. ** P < 0.0005. (Number of tumors analyzed for each host genotype: N wt = 11, N Hb = 12.) ( E-F ) Representative staining of tumors for nuclei (DAPI; blue), NG2 (pericyte marker; red), and pEgfr (green) illustrating that the readily detectable pEgfr signal localized to pericytes in wild-type hosts (white arrows) ( E ) disappears in Hb-egf mutant hosts ( F ). pEgfr can be detected in cancer cells but at many-fold lower levels than in perivascular cells (see Supplementary Fig. S4). Micrographs are representative of 2 fields of 12 and 11 tumors obtained from wt or Hb-egf mutant hosts, respectively.

Article Snippet: Quantitative real-time PCR was performed using the following TaqMan® assays (Applied Biosystems, Foster City, CA) or specifically designed assays: Mm00433023_m1 ( Egfr/Erbb1 ), Mm00658541_m1 ( Erbb2 ), For: cgggacccaccaaggtatc/Rev:ttggtgctcagagcagatgg/Probe:fam-tcatcaagagagcgagtgggcctgg-bhq1 ( Erbb3 ), For: gctgctcaggaccaaaggac/Rev:agtaacgcaggctccactgtc/Probe:fam-ctgactgctttgcctgcatgaacttca-bhq1 ( Erbb4 ), Mm00438696_m1 ( Egf ), Mm00437583_m1 ( Areg ), Mm00504344_m1 ( Epg ), Mm00446231_m1 ( Tgfa ), Mm00514794_m1 ( Epr ), Mm00432137_m1 ( Btc ), Mm00439307_m1 ( Hb-egf/Dtr ), Mm00626552_m1 ( Nrg-1 ), For:aatggaggcgtgtgctactaca/Rev:ccgaagaatccgtttggaca/Probe:fam-cgaaggcatcaaccaactctcctgca-bhq1 ( Nrg-2a ), For: tggaggcgtgtgctactacatc/Rev:cccggtgtatcccacagg/Probe: fam-aaggcatcaaccaactctcctgcaagtg-bhq1 ( Nrg-2b ), Mm004- 35367_m1 ( Nrg-3 ), Mm00446254_m1 ( Nrg-4 ), Hs01076092_m1 (Human EGFR), Hs00961131_m1 (Human HBEGF), Hs00177401_m1 (Human TGF-α), For:ctcatctggaatttcgccga/Rev:ggcgagtgaagatccccttc/Probe:fam-cgaaccagtcaccgctgagagtaatcg-bhq1 ( mGus ), Mm00435546_m1 ( PDGFR -β), Mm00476702_m1 ( Pecam1/CD31 ), and Mm00448463_m1 ( Ptprt/CD45 ).

Techniques: Derivative Assay, Staining, Marker, Confocal Microscopy, Expressing, Comparison, Mutagenesis

(A) Quantitative reverse-transcription polymerase chain reaction (qRT–PCR) with total RNA extracted from 4-week-old mouse ovary (Ov), uterus (Ut), testis (Te), kidney (Ki), lung (Lu), heart (He), liver (Li), brain (Br), stomach (St), intestines (In), muscle (Mu), spleen (Sp) were performed. Results were normalized to the abundance in the ovary and expressed as the mean ± SEM. (B) In situ hybridization of fixed, paraffin wax-embedded 6 µm ovary sections probed with DIG-labeled Nlrp2 oligonucleotide probes. The original magnification was ×100. (C) The relative abundance of Nlrp2 transcripts in mouse oocytes and preimplantation embryos. (D) The relative abundance of Nlrp2 transcripts in different mouse cells.

Journal: PLoS ONE

Article Title: Nlrp2 , a Maternal Effect Gene Required for Early Embryonic Development in the Mouse

doi: 10.1371/journal.pone.0030344

Figure Lengend Snippet: (A) Quantitative reverse-transcription polymerase chain reaction (qRT–PCR) with total RNA extracted from 4-week-old mouse ovary (Ov), uterus (Ut), testis (Te), kidney (Ki), lung (Lu), heart (He), liver (Li), brain (Br), stomach (St), intestines (In), muscle (Mu), spleen (Sp) were performed. Results were normalized to the abundance in the ovary and expressed as the mean ± SEM. (B) In situ hybridization of fixed, paraffin wax-embedded 6 µm ovary sections probed with DIG-labeled Nlrp2 oligonucleotide probes. The original magnification was ×100. (C) The relative abundance of Nlrp2 transcripts in mouse oocytes and preimplantation embryos. (D) The relative abundance of Nlrp2 transcripts in different mouse cells.

Article Snippet: The negative control siRNA (Ambion, Silencer® negative control #1, AM4611) or the custom-made Nlrp2 siRNA (mixture of three target-specific 19–25 nt siRNA designed to knock down mouse Nlrp2 expression; Santa Cruz, sc-149811) was diluted into Opti-MEM® I (Invitrogen) medium.

Techniques: Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, In Situ Hybridization, Labeling

(A) Immunohistochemical analysis of sequential sections from a 3-week-old mouse ovary using an anti-NLRP2 antibody. The original magnification was ×40. (B) Immunofluorescent detection of NLRP2 in cumulus–oocyte complexes after permeabilization and incubation with an anti-NLRP2 antibody. The original magnification was ×100. (C) Immunoblots of lysates isolated from oocytes and preimplantation embryos. Molecular masses (KDa) are indicated on the left; β-actin was used as a control.

Journal: PLoS ONE

Article Title: Nlrp2 , a Maternal Effect Gene Required for Early Embryonic Development in the Mouse

doi: 10.1371/journal.pone.0030344

Figure Lengend Snippet: (A) Immunohistochemical analysis of sequential sections from a 3-week-old mouse ovary using an anti-NLRP2 antibody. The original magnification was ×40. (B) Immunofluorescent detection of NLRP2 in cumulus–oocyte complexes after permeabilization and incubation with an anti-NLRP2 antibody. The original magnification was ×100. (C) Immunoblots of lysates isolated from oocytes and preimplantation embryos. Molecular masses (KDa) are indicated on the left; β-actin was used as a control.

Article Snippet: The negative control siRNA (Ambion, Silencer® negative control #1, AM4611) or the custom-made Nlrp2 siRNA (mixture of three target-specific 19–25 nt siRNA designed to knock down mouse Nlrp2 expression; Santa Cruz, sc-149811) was diluted into Opti-MEM® I (Invitrogen) medium.

Techniques: Immunohistochemical staining, Incubation, Western Blot, Isolation

(A) Subcellular localization of NLRP2 protein in immature mouse oocytes. Using an anti-NLRP2 antibody and ultrathin ovarian sections of 10-day-old mice, immunogold reactions were examined by transmission electron microscopy. Black spots with arrows are immunogold particles indicating the presence of NLRP2 protein. a, Oocytes and surrounding granulosa cells (×4,000). The positions of nucleus (i), cytoplasm (ii) and granulosa cells (iii) are indicated. b and c, Oocyte cytoplasm with immunogold particles (×50,000). d, Nucleus with immunogold particles (×50,000). e, Nuclear pore with immunogold particles nearby (×50,000). f, Control oocyte without immunogold particles in the absence of the primary antibody (×50,000). (B) Subcellular localization of NLRP2 protein in mouse granulosa cells. a, Granulosa cell (×15,000). The positions of the nucleus (i) and cytoplasm (ii). b and c, Cytoplasm with immunogold particles (×50,000). d, Nucleus with immunogold particles (×50,000). e, Nucleus and nuclear pore with immunogold particles (×50,000). f, Granulosa cell without immunogold particles in the absence of primary antibody (×50,000).

Journal: PLoS ONE

Article Title: Nlrp2 , a Maternal Effect Gene Required for Early Embryonic Development in the Mouse

doi: 10.1371/journal.pone.0030344

Figure Lengend Snippet: (A) Subcellular localization of NLRP2 protein in immature mouse oocytes. Using an anti-NLRP2 antibody and ultrathin ovarian sections of 10-day-old mice, immunogold reactions were examined by transmission electron microscopy. Black spots with arrows are immunogold particles indicating the presence of NLRP2 protein. a, Oocytes and surrounding granulosa cells (×4,000). The positions of nucleus (i), cytoplasm (ii) and granulosa cells (iii) are indicated. b and c, Oocyte cytoplasm with immunogold particles (×50,000). d, Nucleus with immunogold particles (×50,000). e, Nuclear pore with immunogold particles nearby (×50,000). f, Control oocyte without immunogold particles in the absence of the primary antibody (×50,000). (B) Subcellular localization of NLRP2 protein in mouse granulosa cells. a, Granulosa cell (×15,000). The positions of the nucleus (i) and cytoplasm (ii). b and c, Cytoplasm with immunogold particles (×50,000). d, Nucleus with immunogold particles (×50,000). e, Nucleus and nuclear pore with immunogold particles (×50,000). f, Granulosa cell without immunogold particles in the absence of primary antibody (×50,000).

Article Snippet: The negative control siRNA (Ambion, Silencer® negative control #1, AM4611) or the custom-made Nlrp2 siRNA (mixture of three target-specific 19–25 nt siRNA designed to knock down mouse Nlrp2 expression; Santa Cruz, sc-149811) was diluted into Opti-MEM® I (Invitrogen) medium.

Techniques: Transmission Assay, Electron Microscopy

(A) The relative abundance of Nlrp2 transcripts in mouse oocytes and parthenogenetic embryos. (B) Immunoblots of lysates isolated from parthenogenetic embryos. (C) Confocal microscopic images of parthenogenetic embryos. Each sample was counterstained with DAPI to visualize DNA (blue). The original magnification was ×200.

Journal: PLoS ONE

Article Title: Nlrp2 , a Maternal Effect Gene Required for Early Embryonic Development in the Mouse

doi: 10.1371/journal.pone.0030344

Figure Lengend Snippet: (A) The relative abundance of Nlrp2 transcripts in mouse oocytes and parthenogenetic embryos. (B) Immunoblots of lysates isolated from parthenogenetic embryos. (C) Confocal microscopic images of parthenogenetic embryos. Each sample was counterstained with DAPI to visualize DNA (blue). The original magnification was ×200.

Article Snippet: The negative control siRNA (Ambion, Silencer® negative control #1, AM4611) or the custom-made Nlrp2 siRNA (mixture of three target-specific 19–25 nt siRNA designed to knock down mouse Nlrp2 expression; Santa Cruz, sc-149811) was diluted into Opti-MEM® I (Invitrogen) medium.

Techniques: Western Blot, Isolation

(A) Oocyte maturation rate following electroporation (EP) of GV-stage oocytes in the presence or absence of control and Nlrp2 siRNA. The numbers on top of each bar indicate the numbers of oocyte matured/numbers of oocytes electroporated. (B) The relative abundance of Nlrp2 transcripts after electroporation with Nlrp2 siRNA. The data have been normalized to untreated oocytes. Statistical comparisons were made using ANOVA and LSD tests (* p<0.05). (C) Nlrp2 , Nlrp4f , Nlrp5 , Nlrp9c and Nlrp14 gene expression by qRT–PCR in mouse oocytes at 24 h after electroporation with Nlrp2 siRNA (60 nM). Results were normalized to control siRNA (100 nM) group. * p<0.05. (D) Immunoblots of mouse oocytes at 24 h after electroporation in the presence or absence of control and Nlrp2 siRNA.

Journal: PLoS ONE

Article Title: Nlrp2 , a Maternal Effect Gene Required for Early Embryonic Development in the Mouse

doi: 10.1371/journal.pone.0030344

Figure Lengend Snippet: (A) Oocyte maturation rate following electroporation (EP) of GV-stage oocytes in the presence or absence of control and Nlrp2 siRNA. The numbers on top of each bar indicate the numbers of oocyte matured/numbers of oocytes electroporated. (B) The relative abundance of Nlrp2 transcripts after electroporation with Nlrp2 siRNA. The data have been normalized to untreated oocytes. Statistical comparisons were made using ANOVA and LSD tests (* p<0.05). (C) Nlrp2 , Nlrp4f , Nlrp5 , Nlrp9c and Nlrp14 gene expression by qRT–PCR in mouse oocytes at 24 h after electroporation with Nlrp2 siRNA (60 nM). Results were normalized to control siRNA (100 nM) group. * p<0.05. (D) Immunoblots of mouse oocytes at 24 h after electroporation in the presence or absence of control and Nlrp2 siRNA.

Article Snippet: The negative control siRNA (Ambion, Silencer® negative control #1, AM4611) or the custom-made Nlrp2 siRNA (mixture of three target-specific 19–25 nt siRNA designed to knock down mouse Nlrp2 expression; Santa Cruz, sc-149811) was diluted into Opti-MEM® I (Invitrogen) medium.

Techniques: Electroporation, Expressing, Quantitative RT-PCR, Western Blot

(A) The relative abundance of Nlrp2 transcripts in mouse embryos collected at 2 h, 11 h, 20 h, 29 h and 38 h after electroporation. Results have been normalized to the abundance in untreated zygotes and are expressed as the mean ± SEM. (B) Immunoblots of mouse embryos at 4 h (1-cell), 28 h (2-cell) and 52 h (8-cell) after electroporation.

Journal: PLoS ONE

Article Title: Nlrp2 , a Maternal Effect Gene Required for Early Embryonic Development in the Mouse

doi: 10.1371/journal.pone.0030344

Figure Lengend Snippet: (A) The relative abundance of Nlrp2 transcripts in mouse embryos collected at 2 h, 11 h, 20 h, 29 h and 38 h after electroporation. Results have been normalized to the abundance in untreated zygotes and are expressed as the mean ± SEM. (B) Immunoblots of mouse embryos at 4 h (1-cell), 28 h (2-cell) and 52 h (8-cell) after electroporation.

Article Snippet: The negative control siRNA (Ambion, Silencer® negative control #1, AM4611) or the custom-made Nlrp2 siRNA (mixture of three target-specific 19–25 nt siRNA designed to knock down mouse Nlrp2 expression; Santa Cruz, sc-149811) was diluted into Opti-MEM® I (Invitrogen) medium.

Techniques: Electroporation, Western Blot

(A) Representative micrographs of blastocysts developing from zygotes that had been microinjected with pIRES2 or pIRES2-Nlrp2. Fluorescence images show the expression of GFP. The original magnification was ×100. (B) The blastocyst formation rate of zygotes microinjected with pIRES2 or pIRES2-Nlrp2. (C) The relative abundance of Nlrp2 transcripts after microinjection. (D) Immunoblots of mouse embryos at different stages after microinjection.

Journal: PLoS ONE

Article Title: Nlrp2 , a Maternal Effect Gene Required for Early Embryonic Development in the Mouse

doi: 10.1371/journal.pone.0030344

Figure Lengend Snippet: (A) Representative micrographs of blastocysts developing from zygotes that had been microinjected with pIRES2 or pIRES2-Nlrp2. Fluorescence images show the expression of GFP. The original magnification was ×100. (B) The blastocyst formation rate of zygotes microinjected with pIRES2 or pIRES2-Nlrp2. (C) The relative abundance of Nlrp2 transcripts after microinjection. (D) Immunoblots of mouse embryos at different stages after microinjection.

Article Snippet: The negative control siRNA (Ambion, Silencer® negative control #1, AM4611) or the custom-made Nlrp2 siRNA (mixture of three target-specific 19–25 nt siRNA designed to knock down mouse Nlrp2 expression; Santa Cruz, sc-149811) was diluted into Opti-MEM® I (Invitrogen) medium.

Techniques: Fluorescence, Expressing, Western Blot

(A) Immunostaining of CDX2 (red) and OCT3/4 (green) in morulae and blastocysts developing from zygotes that had been microinjected with pIRES2 or pIRES2-Nlrp2. The original magnification was ×200. (B) TUNEL apoptosis assay of blastocysts (green). Each sample was counterstained with DAPI to visualize DNA (blue). The original magnification was ×200. (C) Number of apoptotic cells in each blastocyst. *p<0.05.

Journal: PLoS ONE

Article Title: Nlrp2 , a Maternal Effect Gene Required for Early Embryonic Development in the Mouse

doi: 10.1371/journal.pone.0030344

Figure Lengend Snippet: (A) Immunostaining of CDX2 (red) and OCT3/4 (green) in morulae and blastocysts developing from zygotes that had been microinjected with pIRES2 or pIRES2-Nlrp2. The original magnification was ×200. (B) TUNEL apoptosis assay of blastocysts (green). Each sample was counterstained with DAPI to visualize DNA (blue). The original magnification was ×200. (C) Number of apoptotic cells in each blastocyst. *p<0.05.

Article Snippet: The negative control siRNA (Ambion, Silencer® negative control #1, AM4611) or the custom-made Nlrp2 siRNA (mixture of three target-specific 19–25 nt siRNA designed to knock down mouse Nlrp2 expression; Santa Cruz, sc-149811) was diluted into Opti-MEM® I (Invitrogen) medium.

Techniques: Immunostaining, TUNEL Assay, Apoptosis Assay

Primer sequences for quantitative real-time PCR.

Journal: PLoS ONE

Article Title: Nlrp2 , a Maternal Effect Gene Required for Early Embryonic Development in the Mouse

doi: 10.1371/journal.pone.0030344

Figure Lengend Snippet: Primer sequences for quantitative real-time PCR.

Article Snippet: The negative control siRNA (Ambion, Silencer® negative control #1, AM4611) or the custom-made Nlrp2 siRNA (mixture of three target-specific 19–25 nt siRNA designed to knock down mouse Nlrp2 expression; Santa Cruz, sc-149811) was diluted into Opti-MEM® I (Invitrogen) medium.

Techniques:

MZB1 is a highly expressed protein in lymph nodes from SLE patients. a Volcano plot showing distribution of all proteins in lymph nodes from SLE patients ( n = 3) and controls ( n = 3) analyzed by LC-MS. Horizontal line denotes fold change. Vertical line represents p value (ANOVA). Differences > 1.5-fold change and p ≤ 0.05 considered statistically significant. Fold-change values indicate higher (+) and lower (–) expression in SLE patients compared with controls. Significant proteins labeled with their gene name. b Representative immunoblotting for MZB1 in lymph node tissue from SLE patients and controls. Right: Quantification of the immunoblot ( n = 3 each). Mean band intensity ratio measured as the intensity of the MZB1 band divided by intensity of the corresponding beta-actin band. Error bars indicate SEM. c Upper: histological section of an axillary lymph node from SLE patients showing reactive follicular hyperplasia. HE, scale bar = 100 μm. Middle: MZB1 immunostaining of the same sample of the upper image, showing numerous positive cells in the interfollicular area and within the germinal center. Scale bar = 50 μm. Lower: MZB1 immunostaining of the control. Scale bar = 50 μm. d MZB1 + cells in lymph nodes from SLE patients were significantly more frequently observed in the germinal center and interfollicular areas compared with those from controls. * p <0.05; ** p <0.01 HPF high-power field, SLE systemic lupus erythematosus

Journal: Arthritis Research & Therapy

Article Title: Increase of MZB1 in B cells in systemic lupus erythematosus: proteomic analysis of biopsied lymph nodes

doi: 10.1186/s13075-018-1511-5

Figure Lengend Snippet: MZB1 is a highly expressed protein in lymph nodes from SLE patients. a Volcano plot showing distribution of all proteins in lymph nodes from SLE patients ( n = 3) and controls ( n = 3) analyzed by LC-MS. Horizontal line denotes fold change. Vertical line represents p value (ANOVA). Differences > 1.5-fold change and p ≤ 0.05 considered statistically significant. Fold-change values indicate higher (+) and lower (–) expression in SLE patients compared with controls. Significant proteins labeled with their gene name. b Representative immunoblotting for MZB1 in lymph node tissue from SLE patients and controls. Right: Quantification of the immunoblot ( n = 3 each). Mean band intensity ratio measured as the intensity of the MZB1 band divided by intensity of the corresponding beta-actin band. Error bars indicate SEM. c Upper: histological section of an axillary lymph node from SLE patients showing reactive follicular hyperplasia. HE, scale bar = 100 μm. Middle: MZB1 immunostaining of the same sample of the upper image, showing numerous positive cells in the interfollicular area and within the germinal center. Scale bar = 50 μm. Lower: MZB1 immunostaining of the control. Scale bar = 50 μm. d MZB1 + cells in lymph nodes from SLE patients were significantly more frequently observed in the germinal center and interfollicular areas compared with those from controls. * p <0.05; ** p <0.01 HPF high-power field, SLE systemic lupus erythematosus

Article Snippet: Quantitative real-time PCR (qRT-PCR) was performed in 384-well plates with TaqMan gene probes and primers designed by Life Technologies for MZB1 (assay ID: Hs00414907_ml) and beta-actin (assay ID: Hs01060665_gl).

Techniques: Liquid Chromatography with Mass Spectroscopy, Expressing, Labeling, Western Blot, Immunostaining, Control

Candidate proteins differentially expressed between SLE patients and controls

Journal: Arthritis Research & Therapy

Article Title: Increase of MZB1 in B cells in systemic lupus erythematosus: proteomic analysis of biopsied lymph nodes

doi: 10.1186/s13075-018-1511-5

Figure Lengend Snippet: Candidate proteins differentially expressed between SLE patients and controls

Article Snippet: Quantitative real-time PCR (qRT-PCR) was performed in 384-well plates with TaqMan gene probes and primers designed by Life Technologies for MZB1 (assay ID: Hs00414907_ml) and beta-actin (assay ID: Hs01060665_gl).

Techniques: Migration, Coagulation

MZB1 is overexpressed in B-cell subsets and MZB1 mRNA increased in peripheral blood B cells from SLE patients with active disease. a Immunofluorescence showed slight colocalization of MZB1 with B-cell marker CD20 and strong colocalization with plasma cell marker CD138 and MZ B-cell marker IRTA1 in lymph nodes from SLE patients. b MZB1 mRNA levels in peripheral blood B cells from SLE patients with active disease (SLE-High) increased by 2.1-fold compared with those in healthy controls (HC) ( p < 0.05). No significant increase in MZB1 mRNA levels observed in peripheral blood B cells from SLE patients with inactive disease (SLE-Low). c Two SLE patients with active disease had follow-up samples collected at 2 months of treatment. Relative MZB1 mRNA expression levels decreased with treatment. d MZB1 immunohistochemistry in tissue from patients with various autoimmune diseases. e Increased proportion of MZB1 + cells observed in lymph nodes from SLE patients and synovial tissue from rheumatoid arthritis (RA) patients compared with control lymph nodes (LN) and tonsils ( p < 0.05). RA, scale bar = 50 μm; lupus nephritis, scale bar = 20 μm. Hashimoto Hashimoto’s thyroiditis, HPF high-power field, IgG4-RD IgG4-related pancreatitis, myositis dermatomyositis, PN polyarteritis nodosa, Pt patient, Sjs Sjögren’s syndrome, SLE systemic lupus erythematosus

Journal: Arthritis Research & Therapy

Article Title: Increase of MZB1 in B cells in systemic lupus erythematosus: proteomic analysis of biopsied lymph nodes

doi: 10.1186/s13075-018-1511-5

Figure Lengend Snippet: MZB1 is overexpressed in B-cell subsets and MZB1 mRNA increased in peripheral blood B cells from SLE patients with active disease. a Immunofluorescence showed slight colocalization of MZB1 with B-cell marker CD20 and strong colocalization with plasma cell marker CD138 and MZ B-cell marker IRTA1 in lymph nodes from SLE patients. b MZB1 mRNA levels in peripheral blood B cells from SLE patients with active disease (SLE-High) increased by 2.1-fold compared with those in healthy controls (HC) ( p < 0.05). No significant increase in MZB1 mRNA levels observed in peripheral blood B cells from SLE patients with inactive disease (SLE-Low). c Two SLE patients with active disease had follow-up samples collected at 2 months of treatment. Relative MZB1 mRNA expression levels decreased with treatment. d MZB1 immunohistochemistry in tissue from patients with various autoimmune diseases. e Increased proportion of MZB1 + cells observed in lymph nodes from SLE patients and synovial tissue from rheumatoid arthritis (RA) patients compared with control lymph nodes (LN) and tonsils ( p < 0.05). RA, scale bar = 50 μm; lupus nephritis, scale bar = 20 μm. Hashimoto Hashimoto’s thyroiditis, HPF high-power field, IgG4-RD IgG4-related pancreatitis, myositis dermatomyositis, PN polyarteritis nodosa, Pt patient, Sjs Sjögren’s syndrome, SLE systemic lupus erythematosus

Article Snippet: Quantitative real-time PCR (qRT-PCR) was performed in 384-well plates with TaqMan gene probes and primers designed by Life Technologies for MZB1 (assay ID: Hs00414907_ml) and beta-actin (assay ID: Hs01060665_gl).

Techniques: Immunofluorescence, Marker, Clinical Proteomics, Expressing, Immunohistochemistry, Control

Splenic marginal zone B cells and plasma cells show elevated MZB1 levels in aged lupus-prone mice. a MZB1 immunohistochemistry in young (10 weeks of age) and aged (30 weeks of age) BWF1 mice. Spleen, scale bar = 50 μm; kidney, salivary gland, scale bars = 20 μm. b Increased proportion of MZB1 + cells observed in various organs in aged BWF1 mice compared with young BWF1 mice (ANOVA, p < 0.05). c Spleen cells sorted as B220 + CD21 high CD23 low (MZ B cells) and B220 – CD138 + (plasma cells). Percentages of B-cell subsets among total spleen cells in young (10–12 weeks of age) and aged (30–34 weeks of age) BWF1 mice compared with those in aged (30–34 weeks of age) B6 mice ( n = 3–5 each group). Proportion of total MZ B cells increased on average by 8.8% in aged BWF1 mice compared with young BWF1 and B6 mice (ANOVA, p < 0.05). d MZB1 expression in each B-cell subset in young (10–12 weeks of age) and aged (30–34 weeks of age) BWF1 mice compared with aged (30–34 weeks of age) B6 mice ( n = 3–5 each group). MZB1 expression in MZ B cells in aged BWF1 mice significantly higher than that in B6 mice ( p < 0.05). In plasma cells, MZB1 expression in aged BWF1 mice significantly higher than that in young BWF1 and B6 mice (ANOVA, p < 0.05). e Representative histogram of MZB1 expression in MZ B cells in aged B6 mice and young and aged BWF1 mice. Blue line represents isotype control. GC germinal center, FoB follicular B, HPF high-power field, gland salivary gland, IF interfollicular area, LN lymph node, MZ B marginal zone B, w weeks, * p <0.05

Journal: Arthritis Research & Therapy

Article Title: Increase of MZB1 in B cells in systemic lupus erythematosus: proteomic analysis of biopsied lymph nodes

doi: 10.1186/s13075-018-1511-5

Figure Lengend Snippet: Splenic marginal zone B cells and plasma cells show elevated MZB1 levels in aged lupus-prone mice. a MZB1 immunohistochemistry in young (10 weeks of age) and aged (30 weeks of age) BWF1 mice. Spleen, scale bar = 50 μm; kidney, salivary gland, scale bars = 20 μm. b Increased proportion of MZB1 + cells observed in various organs in aged BWF1 mice compared with young BWF1 mice (ANOVA, p < 0.05). c Spleen cells sorted as B220 + CD21 high CD23 low (MZ B cells) and B220 – CD138 + (plasma cells). Percentages of B-cell subsets among total spleen cells in young (10–12 weeks of age) and aged (30–34 weeks of age) BWF1 mice compared with those in aged (30–34 weeks of age) B6 mice ( n = 3–5 each group). Proportion of total MZ B cells increased on average by 8.8% in aged BWF1 mice compared with young BWF1 and B6 mice (ANOVA, p < 0.05). d MZB1 expression in each B-cell subset in young (10–12 weeks of age) and aged (30–34 weeks of age) BWF1 mice compared with aged (30–34 weeks of age) B6 mice ( n = 3–5 each group). MZB1 expression in MZ B cells in aged BWF1 mice significantly higher than that in B6 mice ( p < 0.05). In plasma cells, MZB1 expression in aged BWF1 mice significantly higher than that in young BWF1 and B6 mice (ANOVA, p < 0.05). e Representative histogram of MZB1 expression in MZ B cells in aged B6 mice and young and aged BWF1 mice. Blue line represents isotype control. GC germinal center, FoB follicular B, HPF high-power field, gland salivary gland, IF interfollicular area, LN lymph node, MZ B marginal zone B, w weeks, * p <0.05

Article Snippet: Quantitative real-time PCR (qRT-PCR) was performed in 384-well plates with TaqMan gene probes and primers designed by Life Technologies for MZB1 (assay ID: Hs00414907_ml) and beta-actin (assay ID: Hs01060665_gl).

Techniques: Clinical Proteomics, Immunohistochemistry, Expressing, Control

ER stress induces apoptosis of MZB1 + cells in target organs resulting in decreased serum dsDNA. a Baseline expression of MZB1 and BiP assessed on BWF1 mice at ages of 23 and 34 weeks and there were elevated levels at 34 weeks of age. b MZB1 and BiP expression in spleens from BWF1 mice (25 weeks of age) before or after indicated time points (hours and days) following TM treatment. Beta-actin used as a loading control. Representative blot of three independent experiments with similar results. c Number of TUNEL-positive cells per HPF in kidney and salivary gland of aged BWFI mice (30 weeks of age) serially taken after TM treatment was quantified. d ( Upper ) TUNEL-positive cells present among inflammatory cells in the kidney. ( Lower ) Condensed and fragmented nuclei in MZB1 + cells from BWF1 mice kidney following TM treatment. e Anti-dsDNA antibody concentrations in BWF1 mice ( n = 7; 30 weeks of age) measured serially by ELISA following TM treatment. B6 mice ( n = 2; 30 weeks of age) used as control. TUNEL, TdT-mediated dUTP nick end labeling; HPF, high-power field; hr, hour; * p <0.05

Journal: Arthritis Research & Therapy

Article Title: Increase of MZB1 in B cells in systemic lupus erythematosus: proteomic analysis of biopsied lymph nodes

doi: 10.1186/s13075-018-1511-5

Figure Lengend Snippet: ER stress induces apoptosis of MZB1 + cells in target organs resulting in decreased serum dsDNA. a Baseline expression of MZB1 and BiP assessed on BWF1 mice at ages of 23 and 34 weeks and there were elevated levels at 34 weeks of age. b MZB1 and BiP expression in spleens from BWF1 mice (25 weeks of age) before or after indicated time points (hours and days) following TM treatment. Beta-actin used as a loading control. Representative blot of three independent experiments with similar results. c Number of TUNEL-positive cells per HPF in kidney and salivary gland of aged BWFI mice (30 weeks of age) serially taken after TM treatment was quantified. d ( Upper ) TUNEL-positive cells present among inflammatory cells in the kidney. ( Lower ) Condensed and fragmented nuclei in MZB1 + cells from BWF1 mice kidney following TM treatment. e Anti-dsDNA antibody concentrations in BWF1 mice ( n = 7; 30 weeks of age) measured serially by ELISA following TM treatment. B6 mice ( n = 2; 30 weeks of age) used as control. TUNEL, TdT-mediated dUTP nick end labeling; HPF, high-power field; hr, hour; * p <0.05

Article Snippet: Quantitative real-time PCR (qRT-PCR) was performed in 384-well plates with TaqMan gene probes and primers designed by Life Technologies for MZB1 (assay ID: Hs00414907_ml) and beta-actin (assay ID: Hs01060665_gl).

Techniques: Expressing, Control, TUNEL Assay, Enzyme-linked Immunosorbent Assay, End Labeling